View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18249_low_4 (Length: 456)
Name: NF18249_low_4
Description: NF18249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18249_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 422; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 422; E-Value: 0
Query Start/End: Original strand, 18 - 451
Target Start/End: Complemental strand, 52797752 - 52797319
Alignment:
| Q |
18 |
ctaccatgtttggctgcataaacctttctggccagaacaataagggagcatcccacacttttggatccctcccaattgcccaaacattcactaaaatttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52797752 |
ctaccatgtttggctgcataaacctttctggccagaacaataagggagcatcccacacttttggatccctcccaattgcccaaacattcactaaaatttg |
52797653 |
T |
 |
| Q |
118 |
tgtctcttttggaatgaagtagtctccaatcatgcaagagtccatggccatgtgaggaaccaaaaaaggaagaggtgggtggagtctcaacgtctccttg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52797652 |
tgtctcttttggaatgaagtagtctccaatcatgcaagagtccatggccatgtgaggaaccaaaaaaggaagaggtgggtgaagtctcaacgtctccttg |
52797553 |
T |
 |
| Q |
218 |
ataactgctttgaggtatggaagactctctatgtccttttcttccattttcctatcagagcttattttgctccttagttccatttgcactttcaataggg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52797552 |
ataactgctttgaggtatggaagactctctatgtccttttcttccattttcctatcagagcttattttgctccttagttccatttgcacttttgataggg |
52797453 |
T |
 |
| Q |
318 |
ttcttgggttgtgcagaagctccgccatcgcccattctagtgtgcttgttgtcgtgtctgtccctgcagtgaacatttcctacaacacaataatattact |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52797452 |
ttcttgggttgtgcagaagctccgccatcgcccattctagtgtgcttgttgtcgtgtctgtccctgcagtgaacatttcctacaacacaataatattact |
52797353 |
T |
 |
| Q |
418 |
atcaatgtcacaaactgccatgattcttctctct |
451 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
52797352 |
atcaatgtcacaaactgccatgattcttctctct |
52797319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University