View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18251_high_17 (Length: 228)
Name: NF18251_high_17
Description: NF18251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18251_high_17 |
 | |
|
| [»] scaffold0154 (2 HSPs) |
| | |
|
| [»] scaffold0189 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0154 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 15 - 224
Target Start/End: Complemental strand, 15404 - 15193
Alignment:
| Q |
15 |
ccatatataaaggaaggaaagggtttcttgattattggaagccatccacaattagttgagttttctttcttctccacaaagcnnnnnnnnnnnnn--cca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
15404 |
ccatatataaaggaaggaaagggtttcttgattattggaagccatccacaattagttgagttttctttcttctccacaaagcaaaaaaaacaaaaaacca |
15305 |
T |
|
| Q |
113 |
aaaccatagaacaaaacaacaattgcaagatggattgggtacgaggagaaactgttggaagaggaagctttgcaactgttaatttagttatacccaaaag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15304 |
aaaccatagaacaaaacaacaattgcaagatggattgggtacgaggagaaactgttggaagaggaagctttgcaactgttaatttagttatacccaaaag |
15205 |
T |
|
| Q |
213 |
caattcaaattc |
224 |
Q |
| |
|
|||||||||||| |
|
|
| T |
15204 |
caattcaaattc |
15193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 124 - 227
Target Start/End: Complemental strand, 24713 - 24610
Alignment:
| Q |
124 |
caaaacaacaattgcaagatggattgggtacgaggagaaactgttggaagaggaagctttgcaactgttaatttagttatacccaaaagcaattcaaatt |
223 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |||||| ||| ||||||| ||| |
|
|
| T |
24713 |
caaaacaacaattctcagatggattgggtacgaggaaaaacagttggaagaggaagctttgcaactgttaatttagctatacctaaagccaattcatatt |
24614 |
T |
|
| Q |
224 |
caac |
227 |
Q |
| |
|
|||| |
|
|
| T |
24613 |
caac |
24610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0189 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 142 - 228
Target Start/End: Original strand, 61 - 147
Alignment:
| Q |
142 |
atggattgggtacgaggagaaactgttggaagaggaagctttgcaactgttaatttagttatacccaaaagcaattcaaattcaact |
228 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| || |||||||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
61 |
atggattgggtacgaggagaagctgttggaagaggtagttttgcaactgttaatttagttatacccaaaggaaattcatattcaact |
147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University