View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18251_high_18 (Length: 220)
Name: NF18251_high_18
Description: NF18251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18251_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 7 - 205
Target Start/End: Original strand, 8322487 - 8322682
Alignment:
| Q |
7 |
agcagaacctgtgttagtattatctcttggaagggacttagcactgctgataataattttaattggaagacaatattaagtagagttattagatgcataa |
106 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8322487 |
agcataacctctgttagtattatctcttggaagggacttagtactgctgataataattttaattggaagacaatattaagtagagtta---gatgcataa |
8322583 |
T |
 |
| Q |
107 |
tctcgtatagtgtggcattaagtttgcattaataatatggaataactgtgcaaacaaaaatctcatgtagtgaaacattttggcctacaataaacaatt |
205 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8322584 |
tctcgtataatgtggcattaagtttgcattaataatatggaataactgtgcaaacaaaaatctcatgtagtgaaacattttggcctacaataatcaatt |
8322682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University