View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18251_low_11 (Length: 270)
Name: NF18251_low_11
Description: NF18251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18251_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 11351598 - 11351851
Alignment:
| Q |
1 |
gttgaattttgataacccttttgtgcttaattactctaaattgctttctgtttcctacttgttgcagaggcaaatatgctatacttggaatcgcctgctg |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11351598 |
gttgaattttgataacccttttatgcttaattactctaaattgctttctgtttcctacttgttgcagaggcaaatatgctatacttggaatcgcctgctg |
11351697 |
T |
|
| Q |
101 |
gtgttggtttctcctattctacaaatgaatcattctacgactccgtgaatgattatttgacaggnnnnnnnaacttctttatgtgcaaaatagcatgtga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11351698 |
gtgttggtttctcctattctacaaatgaatcattctacgactccgtgaacgattatttgacaggtttttttaacttctttatgtgcaaaatagcatgtga |
11351797 |
T |
|
| Q |
201 |
atggtaggtatcacaagaagttgagttgaattattaacttctttttcgtttcat |
254 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11351798 |
atggtagttatcacaagaagttgagttgaattattaacttctttttcgtttcat |
11351851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University