View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18251_low_17 (Length: 230)
Name: NF18251_low_17
Description: NF18251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18251_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 32875306 - 32875517
Alignment:
| Q |
1 |
ggagtgggttatcaatggtttagagaaggaaaaaggatatcctgttgagaatgtgagtgtgtctcttggacgggaccctcgagttacagggtcgaaattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32875306 |
ggagtgggttatcaatggtttagagaaggaaaaaggatatcctgttgagaatgtgagtgtgtctcttggacgtgaccctcgagttacagggtcgaaattg |
32875405 |
T |
|
| Q |
101 |
agcgttgcagtgtttgccggtctttctcgtgctggctgtatggtgttcgatatgggactagctaccacgcctgcttgtttcatgagcacattgttgcctc |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32875406 |
agcgttgcagtgtttgccggtcttgctcgtgctggttgtatggtgttcgatatgggactagctaccacgcccgcttgtttcatgagcacattgttgcctc |
32875505 |
T |
|
| Q |
201 |
catttgtctatg |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32875506 |
catttgtctatg |
32875517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University