View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18255_high_30 (Length: 305)
Name: NF18255_high_30
Description: NF18255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18255_high_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 8 - 286
Target Start/End: Original strand, 14947069 - 14947349
Alignment:
| Q |
8 |
agcagagaatcaaatgaaatcattgaactactcttttggagacaattatttccaaagttcaatcttgcaacttttggtggtataatcgattttagacatc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14947069 |
agcagagaatcaaatgaaatcattgaactactcttttgtagacaattatttccaaagttcaatcttgcaacttttggtggtataatcgattttagacatc |
14947168 |
T |
 |
| Q |
108 |
caaattccaatgcaagtagaaaaatcaaatacaagcaggcttttgaaatatgcttttcattaatttatttttgggatagaagatgcttttgattc--tat |
205 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
14947169 |
caaagtccaatgcaagtagaaaaatcaaatacaagcaggcttttgaaatatgcttttcattaatttatttttgggatagaagatgcttttgattctatat |
14947268 |
T |
 |
| Q |
206 |
attaggttttatctagaattagcatcatttttcacatgtatcaacaaaaataactcaatccttatctcttttcttaaagct |
286 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14947269 |
attaggttttatctaggattagcatcatttttcacatgtatcaacaaaaataactcaatccttatctcttttcttaaagct |
14947349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University