View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18255_low_18 (Length: 407)
Name: NF18255_low_18
Description: NF18255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18255_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 11 - 391
Target Start/End: Complemental strand, 43003719 - 43003336
Alignment:
| Q |
11 |
catcatcatcaacgtggaacacatccaagccataatcactgccgacgaagttctcctcagagacccttcttttgttcaggaactttaagcaagagtccat |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
43003719 |
catcatcatcaacgtggaacacatccaagccataatcactgccgacgaagttctcctcagagacccttcttttgttcaggaacttcaagcaagagtccgt |
43003620 |
T |
 |
| Q |
111 |
aacgacgactcaacaaccaccgtgcttgagacatgtcttgaggcagcttgcagcgtgttagagaacgaaccaaagatgctagaacaagaggcacatactc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43003619 |
aacgacgactcaacaaccaccgtgcttgagacatgtcttgaggcagcttgcagcgtgttagagaacgaaccaaagatgctagaacaagaggcacatactc |
43003520 |
T |
 |
| Q |
211 |
ctctaggtgaactgaaatcaaagaccagaactgaactattgaacaatttggaaggtctttataaatcaaataatgaaagagggattggaacgttttctgt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43003519 |
ctctaggtgaactgaaatcaaagaccagcactgaactattgaacaatttggaaggtctttataaatcaaataatgaaagagggattggaacgttttctgt |
43003420 |
T |
 |
| Q |
311 |
ttgatgaatcaaatatggctatctactccactgccaacaaga---attttgtcgttaaggagctgaggatgctcttggaagcat |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43003419 |
ttgatgaatcaaatatggctatctactccactgccaacaagaaatattttgtcgttaaggagctgaggatgctcttggaagcat |
43003336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University