View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18255_low_37 (Length: 275)
Name: NF18255_low_37
Description: NF18255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18255_low_37 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] scaffold0006 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 16 - 275
Target Start/End: Complemental strand, 7649571 - 7649312
Alignment:
| Q |
16 |
gttgtatgttgctgctttacttctaattgacatgtatttactggtttgaacaaggtgtacttatatagacccacttgagctggatatagaaccaaacact |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7649571 |
gttgtatgttgctgctttacttctaattgacatgtatttactggtttgaacaaggtgtacttatatagacccacttgagctggatatagaaccaaacact |
7649472 |
T |
|
| Q |
116 |
acatgtaattttttgggttctctcacaactcatgttacttggtgacatttgtattgattttgtcactgatatatttcataaaagtttttgtgaattctac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7649471 |
acatgtaattttttgggttctctcacaactcatgttacttggtgacatttgtattgattttggcactgatatatttcataaaagtttttgtgaatggtac |
7649372 |
T |
|
| Q |
216 |
atattagggaaaaatacaacaacctcccttgagttctatctaaatggacctaacatcccc |
275 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7649371 |
atattagggaaaagtacaacaacctctcttgagttctatctaaatggacctaacatcccc |
7649312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 220 - 275
Target Start/End: Original strand, 4799919 - 4799974
Alignment:
| Q |
220 |
tagggaaaaatacaacaacctcccttgagttctatctaaatggacctaacatcccc |
275 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4799919 |
tagggaaaaatataacaacctcccttgagttctatctaaatgcacctaacatcccc |
4799974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 220 - 275
Target Start/End: Original strand, 23833539 - 23833594
Alignment:
| Q |
220 |
tagggaaaaatacaacaacctcccttgagttctatctaaatggacctaacatcccc |
275 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23833539 |
tagggaaaaatataacaacctcccttgagttctatctaaatgcacctaacatcccc |
23833594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 233 - 275
Target Start/End: Complemental strand, 4532988 - 4532946
Alignment:
| Q |
233 |
aacaacctcccttgagttctatctaaatggacctaacatcccc |
275 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
4532988 |
aacaacctcccttgagttatatctaaatgcacctaacatcccc |
4532946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 220 - 268
Target Start/End: Complemental strand, 128522 - 128474
Alignment:
| Q |
220 |
tagggaaaaatacaacaacctcccttgagttctatctaaatggacctaa |
268 |
Q |
| |
|
|||||||| ||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
128522 |
tagggaaacatataacagcctcccttgagttctatctaaatgcacctaa |
128474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 142 - 192
Target Start/End: Original strand, 32090949 - 32090999
Alignment:
| Q |
142 |
aactcatgttacttggtgacatttgtattgattttgtcactgatatatttc |
192 |
Q |
| |
|
|||| |||||| || || |||||||||||||||||| |||||||||||||| |
|
|
| T |
32090949 |
aactaatgttaattagttacatttgtattgattttggcactgatatatttc |
32090999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University