View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18255_low_42 (Length: 254)
Name: NF18255_low_42
Description: NF18255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18255_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 240
Target Start/End: Complemental strand, 45378665 - 45378442
Alignment:
| Q |
14 |
atcatgaaacaaactaaataagatgacatattatttattatctggacggtgctaaactaaatatgacacgtccaaggcagaatccaataccaactcttct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45378665 |
atcatgaaacaaactaaataagatgacatattatttatcatctggacggtgctaaactaaatatgacacgtccaaggcagaatccaataccaactcttct |
45378566 |
T |
 |
| Q |
114 |
ctttccacgtgtccctcgattcatttcatcacaaacattatttattattaattgtatatgagagagggaccattcctattgtttagaaagaattccactt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45378565 |
ctttccacgtgtccctcgattcatttcatcagaaacattattt---attaattgtatatgagagagggaccattcctattgtttagaaagaattgcactt |
45378469 |
T |
 |
| Q |
214 |
gcatacgccaaatacctaggtagtttg |
240 |
Q |
| |
|
|||||||||||||||||| |||||||| |
|
|
| T |
45378468 |
gcatacgccaaatacctatgtagtttg |
45378442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University