View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18255_low_43 (Length: 252)
Name: NF18255_low_43
Description: NF18255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18255_low_43 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 95 - 236
Target Start/End: Original strand, 6350269 - 6350410
Alignment:
| Q |
95 |
attcaacttggctattgtaatcacacctctgtttccggtagctgaattattattgtctaaatttgatcaaaggcaacctagcaattgaataattgagcct |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6350269 |
attcaacttggctattgtaatcacacctctgtttccggtagctgaattattattgtctaaatttgatcaaaggcaacctagcaattgaataatcgagcct |
6350368 |
T |
 |
| Q |
195 |
tgtcggaaagtgtcattgtcaccactcaatgggtgagaaacc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6350369 |
tgtcggaaagtgtcattgtcaccactcaatggatgagaaacc |
6350410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 6350175 - 6350226
Alignment:
| Q |
1 |
ttacttgttgaagagcttacatttgtgtctatagagttctattggaagtaaa |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6350175 |
ttacttgttgaagagcttacatttgtgtctatagagttctattggaagtaaa |
6350226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University