View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18255_low_46 (Length: 240)
Name: NF18255_low_46
Description: NF18255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18255_low_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 18 - 151
Target Start/End: Complemental strand, 53880853 - 53880720
Alignment:
| Q |
18 |
attgttcactttaatttcttttgtaggttgtcaagtgcttcctagctttgatgtttcgggagatggtggttcgatcaggatccagcagaccgtgattgat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53880853 |
attgttcactttaatttcttttgtaggttgtcaagtgcttcctagctttgatgtttcgggagatggtggttcgatcaggatccagcagaccgtgattgat |
53880754 |
T |
|
| Q |
118 |
gtttttgggtgttaatgattttatgtcatgttga |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
53880753 |
gtttttgggtgttaatgattttatgtcatgttga |
53880720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 18 - 151
Target Start/End: Complemental strand, 53886967 - 53886834
Alignment:
| Q |
18 |
attgttcactttaatttcttttgtaggttgtcaagtgcttcctagctttgatgtttcgggagatggtggttcgatcaggatccagcagaccgtgattgat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53886967 |
attgttcactttaatttcttttgtaggttgtcaagtgcttcctagctttgatgtttcgggagatggtggttcgatcaggatccagcagaccgtgattgat |
53886868 |
T |
|
| Q |
118 |
gtttttgggtgttaatgattttatgtcatgttga |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
53886867 |
gtttttgggtgttaatgattttatgtcatgttga |
53886834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University