View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18255_low_48 (Length: 234)
Name: NF18255_low_48
Description: NF18255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18255_low_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 41964708 - 41964621
Alignment:
| Q |
1 |
atgaagcacatgacaagactagaatttgttgccgccataagaaggtaattaatttcattttatatttggaatcagccatgagatatac |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41964708 |
atgaagcacatgacaagactagaatttgttgccgccataagaaggtaattaatttcattttatatttggaatcagccatgagatatac |
41964621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 163 - 197
Target Start/End: Complemental strand, 41964547 - 41964513
Alignment:
| Q |
163 |
tgaagtggttcaataaatttcatcaatcttcccct |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41964547 |
tgaagtggttcaataaatttcatcaatcttcccct |
41964513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 24562515 - 24562461
Alignment:
| Q |
1 |
atgaagcacatgacaagactagaatttgttgccgccataagaaggtaattaattt |
55 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| | || ||||||||| |||||| |
|
|
| T |
24562515 |
atgaagcacatgacaagacaagaatttgttgcctctattagaaggtaactaattt |
24562461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University