View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18256_high_6 (Length: 223)
Name: NF18256_high_6
Description: NF18256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18256_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 12 - 207
Target Start/End: Complemental strand, 10836047 - 10835852
Alignment:
| Q |
12 |
tgagaagaaattgaagaccataaccaacaagacccattgaagcagcaataaacatgacaagagagattggaagatacataagagcaagaccagaagacca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10836047 |
tgagaagaaattgaagaccataaccaacaagacccattgaagcagcaataaacatgacaagagagattggaagatacataagagcaagaccagaagacca |
10835948 |
T |
 |
| Q |
112 |
accaaacactttacccatgtcacttgcagttgctaagtagttaagttgcacttgtgagattttgagtacggatttcattgttgatgagtatgatga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10835947 |
accaaacactttacccatgtcacttgcagttgctaagtagttaagttgcacttgtgagattttgagtacggatttcattgttgatgagtatgatga |
10835852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University