View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18256_low_6 (Length: 238)
Name: NF18256_low_6
Description: NF18256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18256_low_6 |
 | |
|
| [»] scaffold0009 (4 HSPs) |
| | |
|
Alignment Details
Target: scaffold0009 (Bit Score: 81; Significance: 3e-38; HSPs: 4)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 18 - 106
Target Start/End: Complemental strand, 172355 - 172267
Alignment:
| Q |
18 |
agcaggaactggaatggtgtcatctgataatgcaacattgaccatgaataatgctactatgatagcaacattaataatataggttcttg |
106 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
172355 |
agcaggaactggaattgtgtcatctgataatgcaacattgaccatgaataatgctactatgatagcaacattaatcatataggttcttg |
172267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 18 - 106
Target Start/End: Complemental strand, 177868 - 177780
Alignment:
| Q |
18 |
agcaggaactggaatggtgtcatctgataatgcaacattgaccatgaataatgctactatgatagcaacattaataatataggttcttg |
106 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
177868 |
agcaggaactggaattgtgtcatctgataatgcaacattgaccatgaataatgctactatgatagcaacattaatcatataggttcttg |
177780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 169 - 238
Target Start/End: Complemental strand, 172207 - 172138
Alignment:
| Q |
169 |
acttgtgtgaatatgtgtgattggttatgcaatttatatgatatttgtgaaacttaatttaggatgtatt |
238 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
172207 |
acttttgtgaatatgtgtgattggttatgcaatttatatgatatttgtgaaacttaatttaggatgtatt |
172138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #4
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 169 - 238
Target Start/End: Complemental strand, 177720 - 177651
Alignment:
| Q |
169 |
acttgtgtgaatatgtgtgattggttatgcaatttatatgatatttgtgaaacttaatttaggatgtatt |
238 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
177720 |
acttttgtgaatatgtgtgattggttatgcaatttatatgatatttgtgaaacttaatttaggatgtatt |
177651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 36 - 106
Target Start/End: Original strand, 31115682 - 31115752
Alignment:
| Q |
36 |
gtcatctgataatgcaacattgaccatgaataatgctactatgatagcaacattaataatataggttcttg |
106 |
Q |
| |
|
||||||||||||| |||||||| | |||||||||||||||||||||||||||| ||| || | ||||||| |
|
|
| T |
31115682 |
gtcatctgataatacaacattggctgtgaataatgctactatgatagcaacattgatagtagatgttcttg |
31115752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 18 - 106
Target Start/End: Original strand, 28285247 - 28285335
Alignment:
| Q |
18 |
agcaggaactggaatggtgtcatctgataatgcaacattgaccatgaataatgctactatgatagcaacattaataatataggttcttg |
106 |
Q |
| |
|
|||||||| ||||| ||||||||||||||| || | |||||| | |||||| |||||||||||||| ||||||| ||||||||||| |
|
|
| T |
28285247 |
agcaggaatcggaattgtgtcatctgataatacacctttgaccgtaaataataatactatgatagcaatattaatagcataggttcttg |
28285335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 228
Target Start/End: Original strand, 28285377 - 28285436
Alignment:
| Q |
169 |
acttgtgtgaatatgtgtgattggttatgcaatttatatgatatttgtgaaacttaattt |
228 |
Q |
| |
|
|||||||||||||||||| |||||| || |||||||||||||||| ||| ||||||||| |
|
|
| T |
28285377 |
acttgtgtgaatatgtgtaattggtgctggaatttatatgatatttctgagacttaattt |
28285436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University