View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18257_high_10 (Length: 291)
Name: NF18257_high_10
Description: NF18257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18257_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 9 - 124
Target Start/End: Original strand, 25295493 - 25295609
Alignment:
| Q |
9 |
acatcatcacaacaattatggaagggaaaaaataaggttcaatgaaaccttaataatct-atgaaaccacatatattatacgatttaaaatgggaaataa |
107 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25295493 |
acatcatcagaacaattatggaagggaaaaaattaggttcaatgaaaccttaataatcttatgaaaccacatatattatacgatttaaaatgggaaataa |
25295592 |
T |
|
| Q |
108 |
aaataaaaagaggtact |
124 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
25295593 |
aaataaaaagaggtact |
25295609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 145 - 258
Target Start/End: Original strand, 25295602 - 25295710
Alignment:
| Q |
145 |
gaggtactaaaagaatttcaccccattatatcaatcaaccaggtttaactcaaattaataatcttatattgtggactcgtaccctctacagtgccaaaag |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
25295602 |
gaggtactaaaagaatttcaccccattatatcaatccaccaggtttaactcaaattaataatc-tatattgtggac----accctctacagtgccaaaag |
25295696 |
T |
|
| Q |
245 |
aggaagaatcaata |
258 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
25295697 |
aggaagaatcaata |
25295710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University