View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18257_high_9 (Length: 298)
Name: NF18257_high_9
Description: NF18257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18257_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 21 - 286
Target Start/End: Complemental strand, 17576552 - 17576275
Alignment:
| Q |
21 |
ctagagatagagttgagtccacagaatcttcatgtgaccttgccatgtactagagttagagttgagtccacttctttaacgtggagggcccaatttaggc |
120 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17576552 |
ctagagatagagttgagtccacagaattttcatgtgaccttgccatgcactagagttagagttgagtccacttctttaacgtggagggcccaatttaggc |
17576453 |
T |
|
| Q |
121 |
tttgt------------agcaaaagggaagggagggctttggggaaagggaaatggaaaggatgatatcccccaccttacttcggggtttatttttcttc |
208 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17576452 |
tttgtttgagaattaggagcaaaagggaagggagggctttggggaaagggaaatggaaaggatgatatcccccaccttacttcggggtttatttttcttc |
17576353 |
T |
|
| Q |
209 |
ataactattgcattatttaaattatgtcaagccttatactatcaagtttttatgctagtccttatcctgtcctatgct |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17576352 |
ataactattgcattatttaaattatgtcaagccttatactatcaagtttttatactagtccttatcctgtcctatgct |
17576275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 49 - 91
Target Start/End: Complemental strand, 17576573 - 17576531
Alignment:
| Q |
49 |
ttcatgtgaccttgccatgtactagagttagagttgagtccac |
91 |
Q |
| |
|
|||||||||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
17576573 |
ttcatgtgaccttgtcctgtactagagatagagttgagtccac |
17576531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University