View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18257_low_10 (Length: 313)
Name: NF18257_low_10
Description: NF18257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18257_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 17 - 227
Target Start/End: Original strand, 41148838 - 41149048
Alignment:
| Q |
17 |
aagagtgtggaagatgaagttgggtggttgagagtgtcgtagagagagatgagtttggcggcaatgaagggattggtggagttgccggtggtgactgtga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41148838 |
aagagtgtggaagatgaagttgggtggttgagagtgtcgtagagagagatgagtttggcggcaatgaagggattggtggagttgccggtggtgactgtga |
41148937 |
T |
|
| Q |
117 |
cggcgtggaatgggaggagagattgaagggttgtgatgcgctttgagagagagatgagttcgccatggtcgagtttcagcatagatattcgcatcatcat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41148938 |
cggcgtggaatgggaggagagattgaagggttgtgatgcgctttgagagagagatgagttcgccatggtcgagtttcagcatagatattcgcatcatcat |
41149037 |
T |
|
| Q |
217 |
tctctatgttc |
227 |
Q |
| |
|
||||||||||| |
|
|
| T |
41149038 |
tctctatgttc |
41149048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University