View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18258_high_19 (Length: 210)
Name: NF18258_high_19
Description: NF18258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18258_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 15 - 197
Target Start/End: Complemental strand, 14194306 - 14194124
Alignment:
| Q |
15 |
gatgaacttgatgaaagtactgggtgtatttgttcacgacaaccttgtcgtcaagattgtgattaagaatacatcctccatcgtagaacattaaatttgg |
114 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14194306 |
gatgaacttgatgaaaatactgcatgtatttgttcaaaacaacgttgtcgtcaagattgtgattaagaatacatcctccatcctagaacattaaatttgg |
14194207 |
T |
 |
| Q |
115 |
aatgtaagtgtaaccttttccataaaataaaatattgagtctgctcagcagtgcaacaaactatcttatctttatgaacaatt |
197 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14194206 |
aatgtaagtgtaaccttttccttaaaataaaatattgagtctgctgagcagtgcaacaaactatcttatctttatgaacaatt |
14194124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University