View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18258_low_7 (Length: 388)
Name: NF18258_low_7
Description: NF18258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18258_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 3e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 3e-95
Query Start/End: Original strand, 176 - 380
Target Start/End: Original strand, 43551010 - 43551214
Alignment:
| Q |
176 |
actatatatggtttgtgccaatctcagtagtacgtgtgaaatttgaagcattatacaaaattacaacgtgttgtttatgtatagccaatataaaagacaa |
275 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43551010 |
actatatatggtttgtgccaatctcagtggtacgtgtgaaatttgaagcattatacaaaattacaacgtgttgtgtatgtatagccaatataaaagacaa |
43551109 |
T |
 |
| Q |
276 |
gcttgtgaaattatgtaagaagagagataaaaagagaagactgcatcagaaattaggaccatacgtcacgtaccaaatgtcaaacactaacatcttccct |
375 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43551110 |
gctcatgaaattatgtaagaagagagataaaaagagaatactacatcagaaattaggaccatacgtcacgtaccagatgtcaaacactaacatcttccct |
43551209 |
T |
 |
| Q |
376 |
ttgct |
380 |
Q |
| |
|
||||| |
|
|
| T |
43551210 |
ttgct |
43551214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University