View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18259_high_14 (Length: 291)
Name: NF18259_high_14
Description: NF18259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18259_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 52 - 272
Target Start/End: Original strand, 51877722 - 51877941
Alignment:
| Q |
52 |
gtatctggtcagtaaaagtgaatgataacaataattggtatcatgcatgtagagaatttgtattgtatgtaagtatgtagtgtagaatgctttggttgga |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51877722 |
gtatctggtcagtaaaagtgaatgataacaataattggtatcatgcatgtagagaatt-gtattgtatgtaagtatgtagtgtagaatgctttggttgga |
51877820 |
T |
 |
| Q |
152 |
attggaggggccatgttaggaactgcacaaacaaaatccagctattattgcatctgtctacttctcacattacaaataatttggaacagtgtttctgcaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51877821 |
attggaggggccatgttaggaactgcacaaacaaaatccagctattattgcatctgtctacttctcacattacaaataatttggaacagtgtttctgcaa |
51877920 |
T |
 |
| Q |
252 |
tctacaatgccacttccccac |
272 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
51877921 |
tctacaatgccacttccccac |
51877941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University