View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18259_high_19 (Length: 228)
Name: NF18259_high_19
Description: NF18259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18259_high_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 56 - 217
Target Start/End: Original strand, 31556825 - 31556986
Alignment:
| Q |
56 |
atggatagtttcttaattgagaattcttaaaaaatacccataagacacttgtgaacaagaccctttaaaaaattatcagaaaaccaattacgaggataag |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||| | | ||| || |||||||| | |||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
31556825 |
atggatagtttcttaattgagaattcttaaagagtgcccctataacacttgttagcaagaccctttaaaaaattatcagaaaatcaattaccaggataag |
31556924 |
T |
 |
| Q |
156 |
tgtcatcattctctgccccacatttacttgaaaaagctttaaaccataaatccttcttctca |
217 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31556925 |
tgtcatcattctccgccccacatttacttgaaaaagctttaaaccataaatccttcttctca |
31556986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University