View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18259_high_23 (Length: 214)
Name: NF18259_high_23
Description: NF18259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18259_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 41460040 - 41460245
Alignment:
| Q |
1 |
cctctgtagctaatattatttagaaccaagcttctcttaacatttctacctgagattgccgatgtccagcgacaaataataacgaatgtaatacgagttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
41460040 |
cctctgtagctaatattatttagaaccaagcttctcttaacatttctacctgagattgccgatgtccagcgacaaataatatcgagtgtaatacgagttc |
41460139 |
T |
|
| Q |
101 |
tatcaagtggttgtaactagtaaaagtaactgggaagggaaggtagcgaggcg--------tgtataactgctatgaatgattggctcatttttgtcata |
192 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41460140 |
tgtcaagtggttgtaactagtaaaagtaactgggaagggaaggtagcgaggcgtgtacttttgtataactgctatgaatgattggctcatttttgtcata |
41460239 |
T |
|
| Q |
193 |
gtctgt |
198 |
Q |
| |
|
|||||| |
|
|
| T |
41460240 |
gtctgt |
41460245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University