View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18259_low_13 (Length: 293)
Name: NF18259_low_13
Description: NF18259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18259_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 13714141 - 13714417
Alignment:
| Q |
1 |
cattgggtgaaacaggaccatggatggcttaaactcaatgtagatgtcgccttccct-attcagcaagctttacaacttttgggtgttgtgtctgtaact |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13714141 |
cattgggtgaaacaggaccatggatggcttaaactcaatgtagatgtcgccttccctcattcagcaagctttacaacttttgggtgttgtgtctgtaact |
13714240 |
T |
 |
| Q |
100 |
caaatggtcactttgtcatggctcacacgcgcgatggaagcaaatatgtatgtcagtccttgaaggtgaagcgttggcattgttggatgttatttgatta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||| |||||| |||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
13714241 |
caaatggtcactttgtcatggctcacacgcacgatagaagcaaatgtgtatgccagtccttgaaggtgaagtgttggcattgttggatgttattcgatta |
13714340 |
T |
 |
| Q |
200 |
gttgccagcaaaagggtggcaaaacacgatctttgacttagattcctatactttggtagaggctgttatgacccaac |
276 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13714341 |
gttgccagcaaaagggtgggaaaacacgatctttgacttagattcctatactttggtacaggctgttatgacccaac |
13714417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University