View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18259_low_16 (Length: 237)
Name: NF18259_low_16
Description: NF18259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18259_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 3 - 223
Target Start/End: Complemental strand, 33102484 - 33102266
Alignment:
| Q |
3 |
taggatttgtttttgcatttattatgttgacctctaggtgttttataattgttttaagtgatgttatgttcatctttgtttgagtaacataaaatttatg |
102 |
Q |
| |
|
||||||| | ||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33102484 |
taggattaggttttgcatttattgtgttgacctataggtgttttataattgttttaagtgatgttatgtctatctttgtttgagtaacataaaatttatg |
33102385 |
T |
|
| Q |
103 |
caaccttgttaagtgtgtgaatttcttacattgaactgagtttgtgtcttgaaattcatttggtgcaactaagttgaaaaatagagatcatgatagaact |
202 |
Q |
| |
|
||||||||||||||| ||||||||||| ||| |||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||| ||| |||| |
|
|
| T |
33102384 |
caaccttgttaagtgagtgaatttcttgcatggaactgagtttgtgacttgaaagtcatttggtgcaactaagttgaaaaat--agatcataatataact |
33102287 |
T |
|
| Q |
203 |
aaatttatttttgtgggaagt |
223 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
33102286 |
aaatttatttttgtgggaagt |
33102266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University