View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18259_low_18 (Length: 233)
Name: NF18259_low_18
Description: NF18259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18259_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 3609116 - 3609319
Alignment:
| Q |
18 |
acaaattgtattgatgtctttatgtcaaagcactagcattggaagtatttaaatctatgtgtgatgactcacatacattgtcagatcattcactgttatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
3609116 |
acaaattgtattgatgtctttatgtcaaagcactagcattggaagtatttaaatct--gtgtgatgactcacatacattgtcagatcagtcactattatg |
3609213 |
T |
 |
| Q |
118 |
gtccttgatgtcatcgaaaatgttggtggtaagctatttacaaatttagatttggtcaaaagtatacccaacataatttttctcatgctcaactttttct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3609214 |
gtccttgatgtcatcgaaaatgttggtggtaagctatttacaaatttagatttggtcaaaagtatacctaacataatttttctcatgctcaactttttct |
3609313 |
T |
 |
| Q |
218 |
tctctc |
223 |
Q |
| |
|
|||||| |
|
|
| T |
3609314 |
tctctc |
3609319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University