View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18259_low_20 (Length: 226)
Name: NF18259_low_20
Description: NF18259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18259_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 7e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 75 - 188
Target Start/End: Original strand, 36390395 - 36390506
Alignment:
| Q |
75 |
taagcagataggctacacaccactattcatgatataaagaaaatatttttcatgcattattaccgtcaataatagattatggttattatttgtatgaatt |
174 |
Q |
| |
|
||||| |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
36390395 |
taagcggataggctacac--cattattcatgatataaagaaaatatttttcatgcattattaccgtcaataatagattatgattattatttgcatgaatt |
36390492 |
T |
|
| Q |
175 |
ttaaattatatata |
188 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36390493 |
ttaaattatatata |
36390506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 48
Target Start/End: Original strand, 36390347 - 36390391
Alignment:
| Q |
7 |
gcagatacagagaaca---tttaaatgttcctaatacaagtattt |
48 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36390347 |
gcagatacagagaacactttttaaatgttcctaatacaagtattt |
36390391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University