View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18260_low_7 (Length: 224)
Name: NF18260_low_7
Description: NF18260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18260_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 34626741 - 34626552
Alignment:
| Q |
19 |
actcagtatattccagttactcttcatatttaatttcgtattatcaatcaaggctccacttacatgatagaataaaattaaaattgtgtatacaaagtat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34626741 |
actcagtatattccagttactcttcatatttaatttcgtattatcaatcaaggctccacttacatgatagaataaaattaaaattgtgtatacaaagtat |
34626642 |
T |
|
| Q |
119 |
tggagaccccattaactcacacatcattggtgtgcacagtccagtaagcaatgaggaaagcatgcactgacagactaaatgtgataacaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34626641 |
tggagaccccattaactcacacatcattggtgtgcacagtccagtaagcaatgaggaaagcatgcactgacagactaaatgtgataacaa |
34626552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University