View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18260_low_9 (Length: 210)
Name: NF18260_low_9
Description: NF18260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18260_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 15 - 191
Target Start/End: Complemental strand, 4372219 - 4372043
Alignment:
| Q |
15 |
cacagacaaattagggaggaggaatccagaatacatttcattgggatgtgattcagtgcctgttctagcaggaagaactccacttcaagtctactccgat |
114 |
Q |
| |
|
||||||||||||||| || || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4372219 |
cacagacaaattaggaagaagaaatccagaatacatctcattgggatgtgattcagtgcctgttctagcaggaagaactccacttcaagtctactccgat |
4372120 |
T |
 |
| Q |
115 |
tacatgagaagcttccgtgataggttcacagattatttgggcaatgttatcatagtaagtttcaccaacttggtctt |
191 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4372119 |
tatatgagaagcttccgtgataggttcacagattatttgggcaatgttatcatagtaagtttcaccaacttggtctt |
4372043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 15 - 174
Target Start/End: Complemental strand, 4364627 - 4364468
Alignment:
| Q |
15 |
cacagacaaattagggaggaggaatccagaatacatttcattgggatgtgattcagtgcctgttctagcaggaagaactccacttcaagtctactccgat |
114 |
Q |
| |
|
||||||||||||||| || || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4364627 |
cacagacaaattaggaagaagaaatccagaatacatctcattgggatgtgattcagtgcctgttctagcaggaagaactccacttcaagtctactccgat |
4364528 |
T |
 |
| Q |
115 |
tacatgagaagcttccgtgataggttcacagattatttgggcaatgttatcatagtaagt |
174 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4364527 |
tatatgagaagcttccgtgataggttcacagattatttgggcaatgttatcatagtaagt |
4364468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 15 - 157
Target Start/End: Original strand, 41042927 - 41043069
Alignment:
| Q |
15 |
cacagacaaattagggaggaggaatccagaatacatttcattgggatgtgattcagtgcctgttctagcaggaagaactccacttcaagtctactccgat |
114 |
Q |
| |
|
|||||||| || ||||||||| ||||| || ||||| |||||||||||||||||||||||||||||| |||||||||||| || ||||| || | || |
|
|
| T |
41042927 |
cacagacagatcagggaggagaaatcctgagtacatatcattgggatgtgattcagtgcctgttctaaaaggaagaactcccctccaagtgtatgctgac |
41043026 |
T |
 |
| Q |
115 |
tacatgagaagcttccgtgataggttcacagattatttgggca |
157 |
Q |
| |
|
|||||||| ||||| ||||| || |||| ||||| ||||||| |
|
|
| T |
41043027 |
tacatgaggagctttcgtgacagattcagtgattacttgggca |
41043069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University