View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18261_high_23 (Length: 315)
Name: NF18261_high_23
Description: NF18261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18261_high_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 58 - 268
Target Start/End: Complemental strand, 30683228 - 30683018
Alignment:
| Q |
58 |
gttggaagcatggtgaagtaaccttaggtgtgcaacaattgcacttatttccatcacactttgaatttccacacttaaagctgcaaatagtaacacaatt |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30683228 |
gttggaagcatggtgaagtaaccttaggtgtgcaaccattgcacttatttccatcacactttgaatttccacacttaaagctgcaaatagtaacacaatt |
30683129 |
T |
 |
| Q |
158 |
tgtgccatcacattttgaactttcacactttgtgcatgaattacacttaccatgacaattgaaattgttgcacttgcaagaaccgtgtaaaacagcatgg |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30683128 |
tgtgccatcacattttgaactttcacactttgtgcatgaattacacttaccatgacaattgaaattgttgcacttgcaagaaccgtgtaaaacagcatgg |
30683029 |
T |
 |
| Q |
258 |
catgcctctat |
268 |
Q |
| |
|
||||||||||| |
|
|
| T |
30683028 |
catgcctctat |
30683018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 13 - 61
Target Start/End: Complemental strand, 30683321 - 30683273
Alignment:
| Q |
13 |
atcataaacaaccgtacaattaggtccaatagggtttacaataaggttg |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30683321 |
atcataaacaaccgtacaattaggtccaatagggtttacaataaggttg |
30683273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University