View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18261_high_37 (Length: 228)
Name: NF18261_high_37
Description: NF18261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18261_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 24 - 171
Target Start/End: Original strand, 33903163 - 33903310
Alignment:
| Q |
24 |
ggcagaccaagacaaagctcagtctccttcaggttcaaaccatgccccatagtggccatattccttttggctagtttctcaatgaaatccaaaccttaga |
123 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||| |||| |||||| |
|
|
| T |
33903163 |
ggcagacccagacaaagctcagtctccttcaggttcaaaccatgccccatagtagccatattctttttggctagcttctcaatgaaatacaaagcttaga |
33903262 |
T |
 |
| Q |
124 |
agaataagaagattgtagaatataattgaaaagatataatattgactc |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33903263 |
agaataagaagattgtagaatataattgaaaagatataatattgactc |
33903310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University