View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18261_low_12 (Length: 387)
Name: NF18261_low_12
Description: NF18261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18261_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 304
Target Start/End: Original strand, 12086200 - 12086504
Alignment:
| Q |
1 |
acatttgatagcttttcatttcttctagtaatagtgtatatcttttccatatgttgtatttcacttgaatgtgaaaactcttcattagattgaatatcta |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12086200 |
acatttgaaagcttttcatttcttctagtaatagtgtatatcttttccatatgttgtatttcacttgaatgtgaaaactcttcattagattgaatatcta |
12086299 |
T |
 |
| Q |
101 |
attgtataaatggagcaatattgctagttttgaaccacttttcagatgaagagtgttcaaaggattcaaaattgaaatctgagattgctgaattatccaa |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||| || ||||| ||||||||||||||||||| |
|
|
| T |
12086300 |
attgtataaatggagcaatattgcttgtttttaaccacttttcagatgaagagtgatcaaaggattcaaagttcaaatcaaagattgctgaattatccaa |
12086399 |
T |
 |
| Q |
201 |
tggtgaaagatctataacctccttagacatatttgtgaccaaatttttggttctggtttcatcactatctgataaagatt-caaaacattactactatta |
299 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||||| | ||||||||||| |
|
|
| T |
12086400 |
tggtgaaagttctataacctctttagacatatctgtgaccaaatttttggttttggtttcatcactatctgataaagattccaaaaaactactactatta |
12086499 |
T |
 |
| Q |
300 |
gtttc |
304 |
Q |
| |
|
||||| |
|
|
| T |
12086500 |
gtttc |
12086504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 344 - 380
Target Start/End: Original strand, 12086544 - 12086580
Alignment:
| Q |
344 |
tattttgtgataggtttttgtgtgttcacctttgctt |
380 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12086544 |
tatttagtgataggtttttgtgtgttcacctttgctt |
12086580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University