View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18261_low_15 (Length: 368)
Name: NF18261_low_15
Description: NF18261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18261_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 7e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 178 - 351
Target Start/End: Complemental strand, 33379635 - 33379463
Alignment:
| Q |
178 |
cctagctccctcttttttctctatgaactcttggannnnnnnnnncttttggttctggctttgtaatttttatcttggctacagtggtttatccacttct |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33379635 |
cctagctccctcttttttctctatgaactcttggattttttttttcttttggttctggctttgtaatttttatcttggctacagtggtt-atccacttct |
33379537 |
T |
 |
| Q |
278 |
ttgattcttattaggccagtaattttgaagcaactgttgtattttcccttggattttgagtcatcataatgtgt |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33379536 |
ttgattcttattaggccagtaattttgaagcaactgttgtattttcccttggattttgagtcatcataatgtgt |
33379463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 33379814 - 33379707
Alignment:
| Q |
1 |
tgttctgtggtatcaaagaaacaagttgtggttgcagctgggtctaaagtggttgccacaaatttgtagcatatgatatatccaaacaaggataaattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33379814 |
tgttctgtggtatcaaagaaacaagttgtggttgcagctgggtctaaagtggttgccacaaatttgtagcatatgatatatccaaacaaggataaattga |
33379715 |
T |
 |
| Q |
101 |
tggcatgc |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
33379714 |
tggcatgc |
33379707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University