View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18261_low_16 (Length: 366)
Name: NF18261_low_16
Description: NF18261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18261_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 70 - 355
Target Start/End: Original strand, 42351069 - 42351354
Alignment:
| Q |
70 |
gccttatagtcatactatagtgaattcgttgattgaattaaggtcatcaaatccagaccaaatcatgatttgtgacatttggcttctaagacaactatct |
169 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42351069 |
gccttatagtcatactatagtgaagtcgttgattgaattaaggtcatcaaatccagacgaaatcatgatttgtgacatttgtcttctaagacaactatct |
42351168 |
T |
|
| Q |
170 |
aattaaggctttgggtcctaaaaccttaaccctcctactataaagcctaactcacggttcagtctcatatacattattcctaaccctaaatcttccttct |
269 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| || ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42351169 |
aattaaggctttgggtcctaaaaccctaaccctcctactataaaccctaactcacggtttaggctcatgtacattattcctaaccctaaatcttccttct |
42351268 |
T |
|
| Q |
270 |
catgtgcttacttactagatcgtcgcaatgttttcatgtacactgcctccattgtggagctatcagtcaatcaccaccgttttcat |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42351269 |
catgtgcttacttactagatcgtcgcaatgttttcatgtacaccgcctccattgtggagctatcagtcaatcaccatcgttttcat |
42351354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 42351036 - 42351088
Alignment:
| Q |
19 |
aatagctccac-aatgaattacaatatgaacttgccttatagtcatactatag |
70 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42351036 |
aatagctccaccaatggattacaatatgaacttgccttatagtcatactatag |
42351088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University