View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18261_low_2 (Length: 687)
Name: NF18261_low_2
Description: NF18261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18261_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-147; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-147
Query Start/End: Original strand, 16 - 292
Target Start/End: Original strand, 26540804 - 26541080
Alignment:
| Q |
16 |
attatttctagcctagctagccagtgccagtgccggtgacaccaaggtcttgcttattctcatcttttccagcaccaaagacaggaccacctttaccagc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
26540804 |
attatttctagcctagctagccagtgccagtgccagtgacaccaaggtcttgcttattctcatctttgccagcaccaaagacaggaccaccttttccagc |
26540903 |
T |
|
| Q |
116 |
aggatcatggaccttctcttgcagcttatcaacttgaatgccaccttgatcttcctttgaaaacaaatcagttcttgtacgattttctcctccttctatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26540904 |
aggatcatggaccttctcttgcagcttatcaacttgaatgccaccttgatcttcctttgaaaacaaatcagttcttgtacgattttctcctccttctatt |
26541003 |
T |
|
| Q |
216 |
gattcatatattgttgctgtctttgactcttttggttgtgctccttgtgccccagacatgttctttcactcttttat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26541004 |
gattcatatattgttgctgtctttgactcttttggttgtgctccttgtgccccagacatgttctttcactcttttat |
26541080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 337 - 459
Target Start/End: Original strand, 26541159 - 26541281
Alignment:
| Q |
337 |
tatttagaggcaatgtgacctaccaaaaacaacccacgtacgtgttatgttaacaagccttggatctacacgtgtgccatgtctttgccaagtgtcacta |
436 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26541159 |
tatttagaggcaatgtgacctaccaaaaacaacccacgtacgtgttatgttagcaagccttggatctacacgtgtgccatgtctttgccaagtgtcacta |
26541258 |
T |
|
| Q |
437 |
ttgttttctttttctgccacgtt |
459 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
26541259 |
ttgttttctttttctgccacgtt |
26541281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University