View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18261_low_23 (Length: 315)
Name: NF18261_low_23
Description: NF18261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18261_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 37 - 299
Target Start/End: Complemental strand, 3617656 - 3617397
Alignment:
| Q |
37 |
cagaaacagtgttgtaagtaaaactagaacaaaccagctttagggaaatcagggacgacacgaatcttagttttgatgccatgaagacgaggatcctggt |
136 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3617656 |
cagaaacagtgttgtaagtaaaac-agaacaaaccagctttagggaaatcagggacgacacgaatcttagttttgatgccatgaagacgaggatcctggt |
3617558 |
T |
|
| Q |
137 |
tatggttagtgtaagccgacattgtgtgtgtagaagtgagttgagtccagagaagaggaggagaaagaaagtgggtatatcaatttatgtacgttatatt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3617557 |
tatggttagtgtaagccgacattgtgtgtgtagaaatgagttgagtccagagaagaggaggagaaagaaagtgggtatatcaatttatgtacgttatatt |
3617458 |
T |
|
| Q |
237 |
tatnnnnnnnnnnnnnngtgtgtgcgttgtcaaacaagccagctgctgattattattcctaaa |
299 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3617457 |
tat--agagagagagaggtgtgtgcgttgtcaaacaagccagctgctgattattatccctaaa |
3617397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 63 - 134
Target Start/End: Original strand, 41966228 - 41966299
Alignment:
| Q |
63 |
gaacaaaccagctttagggaaatcagggacgacacgaatcttagttttgatgccatgaagacgaggatcctg |
134 |
Q |
| |
|
||||||||||| ||| ||||||| || || |||||||||||| ||||||||||||||||||| | |||||| |
|
|
| T |
41966228 |
gaacaaaccaggttttgggaaattgggaactacacgaatcttatttttgatgccatgaagacgggaatcctg |
41966299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University