View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18261_low_36 (Length: 237)
Name: NF18261_low_36
Description: NF18261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18261_low_36 |
 | |
|
| [»] scaffold0009 (6 HSPs) |
| | |
|
Alignment Details
Target: scaffold0009 (Bit Score: 122; Significance: 1e-62; HSPs: 6)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 22 - 196
Target Start/End: Original strand, 165495 - 165656
Alignment:
| Q |
22 |
ctagctccgttattgttttaaactttgacccattattactaggcaaacacatgatgaattttgtccctttatgataactaaagactacattcattcataa |
121 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
165495 |
ctagctccattattgttttaaactttgacccattattactaggcaaacacatgatgaattttgtccctttatgataa-----------attcattcataa |
165583 |
T |
|
| Q |
122 |
acaaaaaatttaaaaatattgtaaaatcttaccctaaattttctctcaatattcaaggcctagaatcactcttcc |
196 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
165584 |
acaaaaaat--aaaaatattgtaaaatcttaccctaaattttctctcaatattcaaggcctagaatcactcttcc |
165656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 22 - 196
Target Start/End: Original strand, 177263 - 177424
Alignment:
| Q |
22 |
ctagctccgttattgttttaaactttgacccattattactaggcaaacacatgatgaattttgtccctttatgataactaaagactacattcattcataa |
121 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
177263 |
ctagctccattattgttttaaactttgacccattattactaggcaaacacatgatgaattttgtccctttatgataa-----------attcattcataa |
177351 |
T |
|
| Q |
122 |
acaaaaaatttaaaaatattgtaaaatcttaccctaaattttctctcaatattcaaggcctagaatcactcttcc |
196 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
177352 |
acaaaaaat--aaaaatattgtaaaatcttaccctaaattttctctcaatattcaaggcctagaatcactcttcc |
177424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #3
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 22 - 196
Target Start/End: Original strand, 171750 - 171911
Alignment:
| Q |
22 |
ctagctccgttattgttttaaactttgacccattattactaggcaaacacatgatgaattttgtccctttatgataactaaagactacattcattcataa |
121 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
171750 |
ctagctccattattgttttaaactttgacccattattactaggcaaacacacgatgaattttgtccctttatgataa-----------attcattcataa |
171838 |
T |
|
| Q |
122 |
acaaaaaatttaaaaatattgtaaaatcttaccctaaattttctctcaatattcaaggcctagaatcactcttcc |
196 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
171839 |
acaaaaaat--aaaaatattgtaaaatcttaccctaaattttctctcaatattcaaggcctagaatcactcttcc |
171911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 196 - 237
Target Start/End: Original strand, 165688 - 165729
Alignment:
| Q |
196 |
ctacgagctttcgttttacacatttgtatggttaacaaccac |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
165688 |
ctacgagctttcgttttacacatttgtatggttaacaaccac |
165729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 196 - 237
Target Start/End: Original strand, 171943 - 171984
Alignment:
| Q |
196 |
ctacgagctttcgttttacacatttgtatggttaacaaccac |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
171943 |
ctacgagctttcgttttacacatttgtatggttaacaaccac |
171984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 196 - 237
Target Start/End: Original strand, 177456 - 177497
Alignment:
| Q |
196 |
ctacgagctttcgttttacacatttgtatggttaacaaccac |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
177456 |
ctacgagctttcgttttacacatttgtatggttaacaaccac |
177497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 144 - 193
Target Start/End: Complemental strand, 28285689 - 28285640
Alignment:
| Q |
144 |
aaaatcttaccctaaattttctctcaatattcaaggcctagaatcactct |
193 |
Q |
| |
|
|||| ||||| ||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
28285689 |
aaaaacttacgctaaattttctcttaagattcaaggcctagaatcactct |
28285640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University