View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18261_low_37 (Length: 234)
Name: NF18261_low_37
Description: NF18261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18261_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 118 - 219
Target Start/End: Complemental strand, 4949081 - 4948978
Alignment:
| Q |
118 |
tcgttgttgagtaaacttattgatgtagtagattaaat--tccttcaaatggttaattttgaatgattaaagcctgtcgtatgcttcccaggagatcctt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4949081 |
tcgttgttgagtaaacttattgatgtagtagattaaatattccttcaaatggttaattttggatgattaaagcctgtcgtatgcttcccaggagatcctt |
4948982 |
T |
 |
| Q |
216 |
tgct |
219 |
Q |
| |
|
|||| |
|
|
| T |
4948981 |
tgct |
4948978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 23 - 81
Target Start/End: Complemental strand, 4949176 - 4949118
Alignment:
| Q |
23 |
ctcccatcacagtaccttccttcatggatatagtaaccctagaatccttatcaaaggac |
81 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4949176 |
ctcccatcacaggaccttccttcatggatatagtaaccctagaatccttatcaaaggac |
4949118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University