View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18261_low_41 (Length: 204)
Name: NF18261_low_41
Description: NF18261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18261_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 58 - 190
Target Start/End: Complemental strand, 5402380 - 5402253
Alignment:
| Q |
58 |
tatttgcatagatgtgttgtcatgtcaatactgaatagaatcgtccacataaagtgcgtatttgcttttgtcatccggtgaaaaccattcaaagcatgca |
157 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5402380 |
tatttgcatagatgtgttgtca-----atactgaatagtatcgtccacataaagtgcgtatttgcttttgtcatatggtgaaaaccattcaaagcatgca |
5402286 |
T |
 |
| Q |
158 |
tgcatgtatgctattcttctttcatataaatac |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5402285 |
tgcatgtatgctattcttctttcatataaatac |
5402253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University