View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18262_high_6 (Length: 217)
Name: NF18262_high_6
Description: NF18262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18262_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 201
Target Start/End: Complemental strand, 2038662 - 2038477
Alignment:
| Q |
16 |
gaaacaaaaacaaaaacctagcatgtgtttggaaagtaactttttgaagacatgaatgaatccaaacaagtgattataatacaaagagattgtagcgttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2038662 |
gaaacaaaaacaaaaacctagcatgtgtttggaaagtaactttttgaagacatgaatgaatccaaacaagtgattataatacaaagagattgtagcgttt |
2038563 |
T |
 |
| Q |
116 |
ggattttctaaatttaaactgccaccgtgtctcccgctcatagtcactcattcactattacggtcacgctcagcttttaatattat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2038562 |
ggattttctaaatttaaactgccaccgtgtctcccgctcatagtcactcattcactattacggtcacgctcagcttttaatattat |
2038477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 17 - 53
Target Start/End: Complemental strand, 2039044 - 2039008
Alignment:
| Q |
17 |
aaacaaaaacaaaaacctagcatgtgtttggaaagta |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2039044 |
aaacaaaaacaaaaacctagcatgtgtttggaaagta |
2039008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University