View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18262_low_6 (Length: 237)
Name: NF18262_low_6
Description: NF18262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18262_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 229
Target Start/End: Original strand, 5202518 - 5202730
Alignment:
| Q |
17 |
caaatacatcgtcttcgcccacggcttcggcaccgaccaatcagcatggcagcgcgtgctcccttacttcacccgcagctataaagtcattctctatgac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5202518 |
caaatacatcgtcttcgcccacggcttcggcaccgaccaatcagcatggcagcgcgtgctcccttacttcacccgcagctataaagtcattctctatgac |
5202617 |
T |
 |
| Q |
117 |
ctcgtttgcgccggcagtgtcaaccccgattacttcgattaccgccgctacacaactcttgacgcttacgttgatgacctcctcaacatccttgattccc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5202618 |
ctcgtttgcgccggcagtgtcaaccccgattacttcgattaccgccgctacacaactcttgacgcttacgttgatgacctcctcaacatccttgattccc |
5202717 |
T |
 |
| Q |
217 |
ttcatctcactcg |
229 |
Q |
| |
|
| ||| ||||||| |
|
|
| T |
5202718 |
tccatgtcactcg |
5202730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University