View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18263_low_18 (Length: 264)
Name: NF18263_low_18
Description: NF18263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18263_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 5 - 248
Target Start/End: Original strand, 6274044 - 6274288
Alignment:
| Q |
5 |
ttaaaataataattttggtgtccttgtaaaactgtgccctaggcgcggccgtccctcctgcccacaatgtagatcaactcat-gagtcaagagttaagac |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
6274044 |
ttaaaataataattttggtgtccttgtaaaactgtgccctaggcgcggccgtccctcctgcccacgatgtagatcaactcattgagtcaagagttaagac |
6274143 |
T |
|
| Q |
104 |
gtctaaggagtttgagaaattggttcaagttcaaatcttagcttcttagataatatgtgaatattaaacttcgtccttaaatatgtaaccatcaatcaac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6274144 |
gtctaaggagtttgagaaattggttcaagttcaaatcttagcttcttagataatatgtgaatattaaacttcgtccttgaatatgtaaccatcaatcaac |
6274243 |
T |
|
| Q |
204 |
ttctttgaattttttcgaaatagtcaaactatttcttaatttgtt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6274244 |
ttctttgaattttttcgaaatagtcaaactatttcttaatttgtt |
6274288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University