View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18263_low_24 (Length: 237)
Name: NF18263_low_24
Description: NF18263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18263_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 3982646 - 3982717
Alignment:
| Q |
1 |
tcgtatttaattattttgtggatcgattcagaatgtgaaaaatgcattttatgtttattgattctgttatca |
72 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3982646 |
tcgtatttaattattttgtggattgcttcagaatgtgaaaaatgcattttatgtttattgattctgttatca |
3982717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 174 - 237
Target Start/End: Original strand, 3982714 - 3982777
Alignment:
| Q |
174 |
atcagaagtgtttgacttttcctccctaattcttactaggataccagccagatcacatgcacct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3982714 |
atcagaagtgtttgacttttcctccctaattcttactaggataccagccagatcacatgcacct |
3982777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 103 - 151
Target Start/End: Complemental strand, 12441250 - 12441202
Alignment:
| Q |
103 |
caacactgacacgtcgacaccagtaaaattttgaaaaaatgaactaacc |
151 |
Q |
| |
|
|||||||||||| ||||||||||| ||| |||||||||||||| ||||| |
|
|
| T |
12441250 |
caacactgacacatcgacaccagtcaaaatttgaaaaaatgaattaacc |
12441202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University