View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18263_low_26 (Length: 227)
Name: NF18263_low_26
Description: NF18263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18263_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 8 - 210
Target Start/End: Complemental strand, 7046640 - 7046438
Alignment:
| Q |
8 |
gaaatgaactgagtaattatttctcaatcttttccttatcttcttcattttatattataaacttatcatatttatgagttcaaatcagattatggtaaaa |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
7046640 |
gaaaggaactgagtaattatttctcaatcttttcctcatcttcttcattttatattataaacttatcatatttataagtttaaatcagattatggtaaaa |
7046541 |
T |
 |
| Q |
108 |
atcaaatgtttttaataatccaatgattatgattacattgacggcgtatatgaattaaatcatttatgtttatgttttaaaacatgttttgattggttgg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7046540 |
atcaaatgtttttaataatccaatgattatgattacattgacggcgtatatgaattatatcatttatgtttatgttttaaaacatgttttgattggttgg |
7046441 |
T |
 |
| Q |
208 |
tat |
210 |
Q |
| |
|
||| |
|
|
| T |
7046440 |
tat |
7046438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 8 - 82
Target Start/End: Complemental strand, 7039708 - 7039634
Alignment:
| Q |
8 |
gaaatgaactgagtaattatttctcaatcttttccttatcttcttcattttatattataaacttatcatatttat |
82 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| | | |||| |||||||||||| | ||||||||||||| |
|
|
| T |
7039708 |
gaaaggaactgagtaattatttctcaatcttttccgcttttccttctttttatattatatatttatcatatttat |
7039634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University