View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18264_high_2 (Length: 381)
Name: NF18264_high_2
Description: NF18264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18264_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 341; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 12 - 364
Target Start/End: Original strand, 28841491 - 28841843
Alignment:
| Q |
12 |
acatcatcaaaggtcgcagttaaagcaaaattgtgtcctggcttttcactgtaagtttgatctccttcaaaatcatgaacagcggtcgggcaagtgtcac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28841491 |
acatcatcaaaggtcgcagttaaagcaaaattgtgtcctggcttttcactgtaagtttgatctccttcaaaatcatgaacagcggtcgggcaagtgtcac |
28841590 |
T |
 |
| Q |
112 |
cagccttctttgaggggcaaactgcatcaacgtggcaacctaaagcctgaagagactgaaagggaaccttgacctcatagtcttccatgtaatcctgtga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28841591 |
cagccttctttgaggggcaaactgcatcaacgtggcaacctaaagcctgaagagactgaaagggaaccttgacctcatagtcttccatgtaatcctgtga |
28841690 |
T |
 |
| Q |
212 |
ttgaaaattgttaaaacacgtctcatcaaccatcatagcaataaaggtaaaatgatttatgaaagaacataaaactaaagaaattattggttccagtaga |
311 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28841691 |
ttaaaaattgttaaaacacgtctcatcaaccatcatagcaataaaggtaaaatgatttatgaaagaacataaaactaaagaaattattggttacagtagg |
28841790 |
T |
 |
| Q |
312 |
tgcatggtaaaaacaaaagaaattattggttgcactaggtgcatgacattcct |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28841791 |
tgcatggtaaaaacaaaagaaattattggttgcactaggtgcatgacattcct |
28841843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 162
Target Start/End: Original strand, 28828161 - 28828209
Alignment:
| Q |
114 |
gccttctttgaggggcaaactgcatcaacgtggcaacctaaagcctgaa |
162 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| ||||||||||||| |
|
|
| T |
28828161 |
gccttctttgaggggcaaactgcataagtgtggcatcctaaagcctgaa |
28828209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University