View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18264_high_5 (Length: 305)
Name: NF18264_high_5
Description: NF18264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18264_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 60 - 295
Target Start/End: Complemental strand, 35743346 - 35743108
Alignment:
| Q |
60 |
gtatactgcacattgaaatgtacatgcatgaagaaaaggaaagaaagcagccgacgttagaacaagaaaaaataattgttctgtgacagatggttggttg |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35743346 |
gtatactgcacattgaaatgtacatgcatgaagaaaaggaaagaaagcagccgacgtaagaacaagaaaaaataattgttctgtgacagatggttggttg |
35743247 |
T |
|
| Q |
160 |
tattgtagcaatttgctctattcttttct---gcaaattttattagaaattttaccttcttttttgattggtttatgatatccacgttcatgaaggtgct |
256 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35743246 |
tattgtagcaatttgctctattcttttttataagaaattttattagaaattttaccttcttttttgattggtttaggatatccacgttcatgaaggtgct |
35743147 |
T |
|
| Q |
257 |
tattttgttaccatcattggatggatcatggatgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35743146 |
tattttgttaccatcattggatggatcatcgatgatgat |
35743108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 52
Target Start/End: Complemental strand, 35743765 - 35743731
Alignment:
| Q |
18 |
aagaaaggtccccagttgctaagatttatagcaac |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35743765 |
aagaaaggtccccagttgctaagatttatagcaac |
35743731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University