View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18264_low_14 (Length: 223)
Name: NF18264_low_14
Description: NF18264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18264_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 15 - 162
Target Start/End: Original strand, 41299046 - 41299193
Alignment:
| Q |
15 |
cagagaaagaaggtgaaactaccatcataacggttaactgccccgacaaaactggtcttggttctgatttatgtcgcatcattctcttctttcatctcac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41299046 |
cagagaaagaaggtgaaactaccatcataacggttaactgccccgacaaaactggtcttggttctgatttatgtcgcatcattctcctctttcatctcac |
41299145 |
T |
 |
| Q |
115 |
cattctccgagcaggtaagtaatacatattcaaaattcgttctttctc |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41299146 |
cattctccgagcaggtaagtaatacatattcaaaattcgttctttctc |
41299193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University