View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18266_high_13 (Length: 245)

Name: NF18266_high_13
Description: NF18266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18266_high_13
NF18266_high_13
[»] chr2 (1 HSPs)
chr2 (1-235)||(11179708-11179932)


Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 11179708 - 11179932
Alignment:
1 atatataaaggttccttgtaatgtaaccaacgtctgaaaagaagggatcgaacaaacagcatagagcttttaattttgatatcgaaataaggcgcccaaa 100  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11179708 atatataaaggttccttttaatgtaaccaacgtctgaaaagaagggatcgaacaaacagcatagagcttttaattttgatatcgaaataaggcgcccaaa 11179807  T
101 tattttgcaagttattagatatttcgacatggctctggcttgaacaagtagctaattgtggtgagcacagaattgaatggagttgaatggcactataaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||||||||||    
11179808 tattttgcaagttattagatatttcgacatggctctggcttgaacaagtagctaattgtggtgagcacagaa----------ttgaatggcactataaat 11179897  T
201 gaatgaagaggatcatctcttaagcgtgatcttgc 235  Q
    |||||||||||||||||||||||||||||||||||    
11179898 gaatgaagaggatcatctcttaagcgtgatcttgc 11179932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University