View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18266_high_19 (Length: 221)
Name: NF18266_high_19
Description: NF18266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18266_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 201
Target Start/End: Original strand, 52885539 - 52885725
Alignment:
| Q |
15 |
cagagagccagttagaatcgtgtgatgaatatcttataatgatatgtcaatttttgtctccaaagaacatgtccaattaaggctttcatcctaaaagacc |
114 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52885539 |
cagagagccaattaagatcgtgtgatgaatatcttataatgatatgtcaatatttgtctccaaagaacatgtccaattaaggctttcatcctaaaagacc |
52885638 |
T |
 |
| Q |
115 |
aactcatgactcaagtgcatcttctctaaacttaaaacttaaggctcgcattttatcactgacttaaccattgtaatgtttgcaggt |
201 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52885639 |
aactcatgactcaagtacatcttctctaaacttaaaacttaagactcgcattttatcactgacttaaccattgtaatgtttgcaggt |
52885725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University