View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18266_low_11 (Length: 285)
Name: NF18266_low_11
Description: NF18266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18266_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 152 - 279
Target Start/End: Complemental strand, 37605244 - 37605132
Alignment:
| Q |
152 |
gtaaagatggaaaatgtactacacgtcagtatgcctctactaaaattgtgaaatctgaaaatgtatgtatgagacacatgcagctggttttgtcgtttag |
251 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37605244 |
gtaaagatggaaaatgcactacacgtcggtatgcctctactaaaattgt---------------atgtatgagacacatgcagctggttttgtcgtttag |
37605160 |
T |
 |
| Q |
252 |
tatgggattcacgcacaggttctgctcg |
279 |
Q |
| |
|
|||||||||||||| |||| ||||||| |
|
|
| T |
37605159 |
tatgggattcacgctcaggccctgctcg |
37605132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 61 - 111
Target Start/End: Complemental strand, 37605300 - 37605250
Alignment:
| Q |
61 |
ggataataaatgtattgaaattctagtccttcaatattaacaataattatt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37605300 |
ggataataaatgtattgaaattctagtccttcaatattaacaataaatatt |
37605250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 111 - 159
Target Start/End: Original strand, 39303253 - 39303301
Alignment:
| Q |
111 |
tattttcttataaggactaatccgataataagtaattactcgtaaagat |
159 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||| ||||||| |
|
|
| T |
39303253 |
tattttcttataaggactaatatgataataagtaaatactaataaagat |
39303301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University