View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18266_low_14 (Length: 245)
Name: NF18266_low_14
Description: NF18266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18266_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 11179708 - 11179932
Alignment:
| Q |
1 |
atatataaaggttccttgtaatgtaaccaacgtctgaaaagaagggatcgaacaaacagcatagagcttttaattttgatatcgaaataaggcgcccaaa |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11179708 |
atatataaaggttccttttaatgtaaccaacgtctgaaaagaagggatcgaacaaacagcatagagcttttaattttgatatcgaaataaggcgcccaaa |
11179807 |
T |
 |
| Q |
101 |
tattttgcaagttattagatatttcgacatggctctggcttgaacaagtagctaattgtggtgagcacagaattgaatggagttgaatggcactataaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11179808 |
tattttgcaagttattagatatttcgacatggctctggcttgaacaagtagctaattgtggtgagcacagaa----------ttgaatggcactataaat |
11179897 |
T |
 |
| Q |
201 |
gaatgaagaggatcatctcttaagcgtgatcttgc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11179898 |
gaatgaagaggatcatctcttaagcgtgatcttgc |
11179932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University